Placeholder image of a protein
Icon representing a puzzle

1434: Classroom Puzzle: Phosphates in Biology

Closed since over 8 years ago

Intermediate Pilot

Summary


Created
September 27, 2017
Expires
Max points
100
Description

Note: Due to player feedback and an excessive number of bugs, this puzzle was closed early and is worth zero points.

Welcome to the first of the U. of Denver educational puzzles! In this puzzle, students will be asked to fold an RNA structure to help learn about the distinct chemical and structural properties of phosphorous in nucleic acids. Phosphates are essential to the structure of the RNA backbone; after enabling "Show advanced GUI" in General Options, try adjusting the View options to Stick mode with CPK colors to see the chemical structure of the RNA backbone. The RNA used for this puzzle is a section of Xist RNA, which is very important in gene transcription and cancer, but whose tertiary structure is still unknown. See if you can find a high-scoring structure for this RNA!



U. of Denver students will be asked to read two articles alongside this Foldit puzzle. The first is a landmark 1987 paper by Frank Westheimer discussing the unique role of biological phosphates; the second is a controversial 2010 paper by Wolfe-Simon et al. suggesting arsenic as a viable substitute for phosphorus.

Top groups


  1. Avatar for Natural Abilities 11. Natural Abilities 1 pt. 8,070
  2. Avatar for Italiani Al Lavoro 12. Italiani Al Lavoro 1 pt. 8,049
  3. Avatar for DSN @ Home 13. DSN @ Home 1 pt. 8,033
  4. Avatar for Window Group 14. Window Group 1 pt. 0

  1. Avatar for Superphosphate 71. Superphosphate Lv 1 1 pt. 8,061
  2. Avatar for bendfreeman 72. bendfreeman Lv 1 1 pt. 8,059
  3. Avatar for Leo33 74. Leo33 Lv 1 1 pt. 8,056
  4. Avatar for deLaCeiba 75. deLaCeiba Lv 1 1 pt. 8,049
  5. Avatar for DScott 76. DScott Lv 1 1 pt. 8,046
  6. Avatar for ViJay7019 77. ViJay7019 Lv 1 1 pt. 8,040
  7. Avatar for leehaggis 78. leehaggis Lv 1 1 pt. 8,039
  8. Avatar for senor pit 79. senor pit Lv 1 1 pt. 8,036
  9. Avatar for aspadistra 80. aspadistra Lv 1 1 pt. 8,033

Comments


NinjaGreg Lv 1

Looking at a comparison of the sequence with the same sequence in reverse, we see:

GGUUUUGUGAGUUAUUGCACUACC
CCAUCACGUUAUUGAGUGUUUUGG

By sliding the second row along the first, we can see what matchups might occur. The four U's right after the initial GG do not have a matching sequence of four As, and there is not another GG sequence for the CC at the end to match up with.

alcor29 Lv 1

When dealing with RNA could we have GC one color and AU another color; or have each one have its own color. Either way, it would save some time and effort. Thanks.

frood66 Lv 1

It seems obvious that giving the option of a tool like remix (crashes client) - or the option to cut when a cut cannot be readily closed just causes frustration. Why are such basic bugs still in this puzzle?

No doubt all players have the same prob - but I do not think that is an excuse to be proud of.

Moving into the realms of RNA is interesting on some levels - but many here will have played another game based on this…..please can we do better than that game does?

NinjaGreg Lv 1

  1. Banding
    A. Creating a band where you want it is difficult. Trying to attach to the end of the raised part of a pentagon (the part perpendicular to the pentagon itself), you have to have to the arrow head about halfway down before it snaps to the end. Go too far down, it snaps to the pentagon attachment point. Very hard to predict, and the "snap" areas appear to be very small – had to carefully drag down the post until it snapped, going very slowly so I didn't miss it.
    B. The bands don't work like in the regular puzzle due to the angular nature of the connections. If you want a tryptophan to move just a little closer to another of the residues, any pulling results in either no movement, or movement to one side of the other.
    C. The default setting for the band tool is WAY too strong for this puzzle, it tends to whip the molecules around, rather than moving them gently. A way to say "make all my bands default to X strong" would be cool (also for the regular game!), allowing you to set that to say 0.25, then have all bands from then on start out at only 0.25.

  2. Object of the puzzle.
    A. I tried a reset, followed by a shake and a wiggle, and got up to where any further progress was measured in a very small number of points. IT doesn't reward you very efficiently for trying to find out how to get points. Having to glance up at the score between each move really gets in the way of the flow of the game, perhaps having a number appear after the move would help (the "+1" that appears, then goes away.)
    B. Was the object to try to line up the aromatics of the residues in a spiral? Was it to try to match up the backbone somehow? Never did figure that out, and the lack of score movement noted above didn't help any.

  3. Hydrogen bonds
    A. Seemed like they had some difficulty forming, and even when they did it didn't change the score much. If that's the main way to gain points, the increment should be bigger.
    B. Possibly related to A, the bonds didn't seem very "sticky" when they formed, appearing and disappearing without much effort on my part. Wiggle didn't seem to care about them, as it would just as happily break them as make them.

  4. Colors
    A. Agree with the note above about coloring AU versus GC. Unless the objective was just to line them up in a spiral, in which case it doesn't matter.
    B. Having the color of one of the residues be very similar to the band color made it somewhat confusing.