Susume Lv 1
The sequence of nucleotides (sidechains) for this puzzle is:
GGCAGAUCUGAGCCUGGGAGCUCUCUGCC
Closed since about 8 years ago
Intermediate PilotIn this Classroom puzzle, students will learn about RNA structure and dynamics, as well as the ongoing debate between conformational capture and induced fit models of biomolecular binding. The RNA molecule of choice here, HIV TAR, is provided in one of its many possible folded conformations. However, we know the RNA is flexible, and it is still unclear what fold is most favorable for this molecule. See if you can find other stable folds for this RNA molecule!
University of Denver students will be asked to read two articles alongside this Foldit puzzle. The first is a 2007 article by Zhang et al., which demonstrates an innovative experimental technique for probing the structure and dynamics of this RNA molecule. The second article is a 2009 report by Bardaro et al., in which the authors use more traditional techniques to examine how the structure of this RNA might respond to the presence of binding partners.
The sequence of nucleotides (sidechains) for this puzzle is:
GGCAGAUCUGAGCCUGGGAGCUCUCUGCC
To see hydrogen bonds, turn on show bonds (non-protein) in view menu.
In lua, when using structure.GetAminoAcid(n) on an RNA molecule, foldit returns a 2-letter abbreviation for base n ("ra", "rc", "rg", or "ru").
Wikipedia has a page on secondary structure of RNA, with a few pictures of shapes that RNA can make:
More pics of shapes RNA can make - scroll down to the "secondary structure" section: http://www.sivabio.50webs.com/nucleicacidstructure.htm
We really need a way to straighten out the backbone when it gets twisted (wiggle twists it a LOT when we use bands to move things around). No tweak, no remix, no rebuild, no cutting - it's very hard to recover from twisting!