1463: Classroom Puzzle: HIV RNA

Closed since about 8 years ago

Summary

• Created: December 26, 2017
• Expires: January 03, 2018 at 18:00 UTC
• Max points: 100

Description

In this Classroom puzzle, students will learn about RNA structure and dynamics, as well as the ongoing debate between conformational capture and induced fit models of biomolecular binding. The RNA molecule of choice here, HIV TAR, is provided in one of its many possible folded conformations. However, we know the RNA is flexible, and it is still unclear what fold is most favorable for this molecule. See if you can find other stable folds for this RNA molecule!

University of Denver students will be asked to read two articles alongside this Foldit puzzle. The first is a 2007 article by Zhang et al., which demonstrates an innovative experimental technique for probing the structure and dynamics of this RNA molecule. The second article is a 2009 report by Bardaro et al., in which the authors use more traditional techniques to examine how the structure of this RNA might respond to the presence of binding partners.

Top groups

• 1. Go Science 100 pts. 8,311
• 2. Beta Folders 73 pts. 8,308
• 3. Anthropic Dreams 52 pts. 8,296
• 4. Gargleblasters 36 pts. 8,279
• 5. Deleted group pts. 8,279
• 6. HMT heritage 16 pts. 8,267
• 7. Contenders 10 pts. 8,255
• 8. L'Alliance Francophone 6 pts. 8,252
• 9. Marvin's bunch 4 pts. 8,246
• 10. Void Crushers 2 pts. 8,208

Top soloists

• 71. yoyoparis 6 pts. 8,145
• 72. Flagg65a 6 pts. 8,145
• 73. abiogenesis 6 pts. 8,139
• 74. pfeiffelfloyd 5 pts. 8,138
• 75. Cagdason 5 pts. 8,136
• 76. jobo0502 5 pts. 8,133
• 77. Deleted player pts. 8,133
• 78. SKSbell 4 pts. 8,129
• 79. bcre8tvv 4 pts. 8,128
• 80. christioanchauvin 4 pts. 8,127

Comments

[Susume]

The sequence of nucleotides (sidechains) for this puzzle is:
GGCAGAUCUGAGCCUGGGAGCUCUCUGCC

[Susume]

To see hydrogen bonds, turn on show bonds (non-protein) in view menu.

In lua, when using structure.GetAminoAcid(n) on an RNA molecule, foldit returns a 2-letter abbreviation for base n ("ra", "rc", "rg", or "ru").

Wikipedia has a page on secondary structure of RNA, with a few pictures of shapes that RNA can make:

en.wikipedia.org

Nucleic acid secondary structure

Nucleic acid secondary structure is the basepairing interactions within a single nucleic acid polymer or between two polymers. It can be represented as a list of bases which are paired in a nucleic acid molecule. The secondary structures of biological DNAs and RNAs tend to be different: biological DNA mostly exists as fully base paired double helices, while biological RNA is single stranded and often forms complex and intricate base-pairing interactions due to its increased ability to form hy In...

More pics of shapes RNA can make - scroll down to the "secondary structure" section: http://www.sivabio.50webs.com/nucleicacidstructure.htm

[Susume]

We really need a way to straighten out the backbone when it gets twisted (wiggle twists it a LOT when we use bands to move things around). No tweak, no remix, no rebuild, no cutting - it's very hard to recover from twisting!